Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development
نویسندگان
چکیده
Dengue virus that causes dengue fever and shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method been developed to confirm results easy amplification without complicated equipment. The aim this study was designing capture probe serotyping (DENV) using NALF method. We have conducted an analytical obtain four specific sequences Virus serotypes develop serotipe NALF. Several parameters were used analyzed genome i.e % GC content, target homology, length 100% homology continue non-specific bases, hybridization temperature, secondary structure estimate probe's capability in reaction. probes applied assayed single strand DNA sample check its performance. result sequence probes, DENV1, 2, 3, CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application fabricated gave no cross with high stringency buffer assay.Keywords : probe; virus; hybridization; nucleic acid lateral flow;
منابع مشابه
Sensitivity and Specificity of Nucleic Acid Sequence-Based Amplification Method for Diagnosis of Cutaneous Leishmaniasis
Abstract Background and Objective: Culture, microscopic method is a gold standard method for identification of Lishmania parasite. The use of Molecular methods such as RT- PCR compared to microscopic methods has a higher sensitivity and specificity however, it is not widely used due to its expensive equipment and the time requested. The use of nucleic acid sequence based amplification (NASBA) ...
متن کاملNucleic acid sequence citations: need for more-specific guidelines.
It is a policy of the Journal ofClinical Microbiology (JCM) and other ASM journals to encourage prompt submission of nucleic acid sequences to GenBank/EMBL. As stated in the Instructions to Authors, "It is expected that GenBank/ EMBL accession numbers for primary nucleotide and/or amino acid sequence data will be included in the original manuscript or be inserted when the manuscript is modified...
متن کاملDevelopment of Artificial Lateral-line Flow Sensors
Evolved over hundreds of millions of years, many fish species rely on lateral line sensors to monitor surrounding flow fields for maneuvering and survival under water [1]. It is conjectured that fish is equipped with distance touch sense of underwater obstacles, predators, and prey. A lateral line system, shown in Fig. 1, consists of an array of distributed sensor nodes (so called neuromasts) t...
متن کاملSequence-Specific Nucleic Acid Damage by Peptide Nucleic Acid Conjugates That Can Be
Inhibition of gene expression is of great interest to explore gene function or for therapeutic applications. Oligonucleotides that interact with a specific RNA (antisense strategy) or DNA (antigene strategy) sequence are very attractive to disrupt gene expression. Structural modifications brought to the last generation of oligonucleotides like PNAs (peptide nucleic acids) have led to molecules ...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Jurnal Sain Veteriner
سال: 2021
ISSN: ['2443-1583', '2407-3733']
DOI: https://doi.org/10.22146/jsv.44696